Detailed Information [201488]
 

Strain Information
DGRC Number 201488
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}sti[GS9053] / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV6}stiGS9053 / TM3, Sb1 Ser1
Break points/Insertion Site 69C3
Map Viewer
Related Genes CG10522(CT38848)
Received Date 1/22/03
Original Number 9053
Comments No or little Sb expression. 27Dec2023 E.O.
Received from Tokyo Metropolitan University.
Original Comments Vector: GSV6
Location (tagged genes): 5'UTR
Function / Process (tagged genes): cell cycle regulator
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2023-12-27
Research papers using this strain
[Please submit your publication]
Tran THY, Yang DW, Kim M, Lee DH, Gai M, Di Cunto F, Choi KW, Lim DS.
Citron kinase interacts with LATS2 and inhibits its activity by occluding its hydrophobic phosphorylation motif.
J Mol Cell Biol (2019) 11(11) 1006-1017 [PubMed ID = 30865227] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 12488683 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
GCACTCGTTGTACAGCAGACAGAAGGCGTCCAGGAGTCCCTCGCGGCAGATGGCCTCGGC
CACGGCGGCGCTAGTGGTGCTCACGGGTACAATGCTTCTCCTGGTGGAGGCGGGAATACC
TGATCCGGAGGCGCTTCCAGCGGGCTTCGCACAGACGCCAGCTCCTTTGCCCAGAATCAG
GTTGTTCAGACGCGCGGTGCGCACGCTAATCGGCTCCATCTTGGGTGGCATGATGGACTC
ACTTTTATTTGCAAT
Sequence Comment 3L:12488384..12488683dmel-3L-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 12488683 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
GCATTTTTCTGCCGTTTCGCTTTGAAAAAAATGCGCCGAGGGAAGCCGAAGAGCCAGGGA
TGCGTGCTCACTTTCCAGAGTTGTATTTAGGGTTGCAAGTAGGGCTGCCCTGTGAAAGAG
GATAAAATTTGAATTTTAATGCAAACAGAGAACGGATAAATAATGAAATAGTCTTATTTA
CTTTTGGCAACCTTTTGAAGCGTCCCCTTTTATATTTTGCACAGTTTTGCACATAAACAG
TTATTATTATTATTTCGCTGCCGCCGCCGCTGCTATACAACCGCGCTTTCCAACACCGTC
Sequence Comment 3L:12488683..12488982dmel-3L-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE