Strain Information | |
---|---|
DGRC Number | 202741 |
Genotype with FlyBase Link | y[1] w[67c23]; P{w[+mC]=GSV6}GS10670 / SM1 |
Genotype | y1 w67c23; P{w+mC=GSV6}GS10670 / SM1 |
Break points/Insertion Site | 56D7 |
Map Viewer | |
Related Genes | mei-W68(CT23580) |
Received Date | 3/11/03 |
Original Number | 10670 |
Comments | Received from Tokyo Metropolitan University. |
Original Comments | Vector: GSV6 Location (tagged genes): Intron Function / Process (tagged genes): DNA topoisomerase |
General Information | GS_lines |
Genus | Drosophila |
Subgenus | Sophophora |
Species Group | melanogaster |
Species Subgroup | melanogaster |
Species | melanogaster |
Reference | Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [RRC reference] |
Last update | 2022-02-15 |
Research papers using this strain [Please submit your publication] |
Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference] Barclay SS, Tamura T, Ito H, Fujita K, Tagawa K, Shimamura T, Katsuta A, Shiwaku H, Sone M, Imoto S, Miyano S, Okazawa H. Systems biology analysis of Drosophila in vivo screen data elucidates core networks for DNA damage repair in SCA1. Hum Mol Genet (2014) 23(5) 1345-64 [PubMed ID = 24179173] [RRC reference] |
Stock Request |
Library & Clone Information |
---|
Library Name / Clone Name | GSV6 |
Insertion Point | 14972022 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
Flanking Sequence | GGCAACAACAACAACAACAGCAGCGACCATCAGCTAGCGACTCCTCTCTGAGCGAGAGAG CTAATAGCTTTTCAGCTTTAGCTTTTCTTGGGCCAATCGGAAATTGTATTTCATTGGTAA GTACAAGAAGTGGCAGCACCATAACCAGCAAATCAATACTTGGGCTGCCATTCCGTTTCG TTCCGTTCGTCAGTTTTCCTAGCCCATTCGTTGGCGCTCTCTCTTTTCCGTCAGTCTCTC TCTTTCTCTTCCCCA |
Sequence Comment | 2R:14971723..14972022dmel-2R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data. |
Library Name / Clone Name | GSV6 |
Insertion Point | 14972022 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
Flanking Sequence | TGCTTTGTAATAACGAGTACACTTTTCTGCACATACGAAAAAGAAGGAAAAAAGAATAAT AAAATAAGAAGAAAAAATGAAAGACCGAATAAAGAAATTCACATAAACTTATGGCACTCT CCCTCGCGCTCTCTTCATTTGCAACTAGTGTGCGTGCTTAAATTTTTAAAAAACAGTTGT TTTCACCGAAAGGGAATTTTCATTTCGATGGTATATTTTTAGCCAGCAAGCTCCTTTCGG AAATTATTTATAACCCCCCTCGAAATGTTTCCACGCAACGATTTACGCGATAAACTTTTA |
Sequence Comment | 2R:14972022..14972321dmel-2R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data. |