Detailed Information [203892]

Strain Information
DGRC Number 203892
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV6}GS12194 / TM3, Sb[1] Ser[1]
Genotype y1 w67c23; P{w+mC=GSV6}GS12194 / TM3, Sb1 Ser1
Break points/Insertion Site 88B5
Map Viewer
Related Genes trx(CT25007)
Received Date 3/25/03
Original Number 12194
Comments Received from Tokyo Metropolitan University.
Original Comments Vector: GSV6
Location (tagged genes): Intron
Function / Process (tagged genes): DNA binding
General Information GS_lines
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Last update 2015-08-20
Research papers using this strain
[Please submit your publication]
Sadasivam DA, Huang DH.
Maintenance of Tissue Pluripotency by Epigenetic Factors Acting at Multiple Levels.
PLoS Genet. (2016) 12(2) e1005897 [PubMed ID = 26926299] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV6
Insertion Point 10104693 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
ACCACCTTTGCACGCTTTGCCACCACTAAGTGTGTGCAGTTTACGAAAAAACAAAAAAAA
ATTGAAGCAAAACAACTGCTGCGTTGTGGCTCCTTAAACTCATTCCGTTTTCTTTGGCAC
GTAGCACGCGCTCTCTCTGTCTCTCTTTCTCGCAGACTCCTTTTTAAGAAATGCTCTCAC
ACTCCAAACGCGCTCCCGCTCTCTCTCTCTCTCTCTCTTGGCAACTACCTTTCTCCCTCC
CTCCCGCGAGCTAGT
Sequence Comment 3R:10104394..10104693dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV6
Insertion Point 10104693 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Flanking Sequence
TTTTTTGTTTCTTGTTGCTGTTGTTTTCTTTGCAGGATTTTCTCGTTCGGCTTTTGTTGT
TGCTGCTGCCTTTGTTTTTTTCCCTGGGATATTTTTTGTTTGCTGGAAATTGAAATTCTT
ACAGTTGTTGTTGTTGTTGCTGCTGCTGCGGATGGCGTTGTTGCTGTTGTGGGCCACTAT
TAAGTGGTGGGTTTTCCCTACTGCTGGCTCTTTTTACGACAGTTTTTCTCTTTGTTCTCG
CTTTTATGGCCTGATGAAAATTCTTCTTTTTGCGCGTTTAGTTTTTCTGCGTTGGGAGTT
Sequence Comment 3R:10104693..10104992dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.


CLOSE