| Strain Information | |
|---|---|
| DGRC Number | 203904 |
| Genotype with FlyBase Link | y[1] w[67c23]; P{w[+mC]=GSV6}twin[GS12209] / TM3, Sb[1] Ser[1] |
| Genotype | y1 w67c23; P{w+mC=GSV6}twinGS12209 / TM3, Sb1 Ser1 |
| Break points/Insertion Site | 95E7 |
| Map Viewer |  |
| Related Genes | CG17741(CT33003) |
| Received Date | 3/25/03 |
| Original Number | 12209 |
| Comments | Received from Tokyo Metropolitan University. |
| Original Comments | Vector: GSV6 Location (tagged genes): Undefined(UTR or exon) Function / Process (tagged genes): actin binding |
| General Information | GS_lines |
| Genus | Drosophila |
| Subgenus | Sophophora |
| Species Group | melanogaster |
| Species Subgroup | melanogaster |
| Species | melanogaster |
| Reference | Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [RRC reference] |
| Last update | 2022-02-15 |
| Research papers using this strain [Please submit your publication] |
Pradhan SJ, Nesler KR, Rosen SF, Kato Y, Nakamura A, Ramaswami M, Barbee SA. The conserved P body component HPat/Pat1 negatively regulates synaptic terminal growth at the larval Drosophila neuromuscular junction. J Cell Sci (2012) 125(Pt 24) 6105-16 [PubMed ID = 23097047] [RRC reference] Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference] Zaessinger S, Busseau I, Simonelig M. Oskar allows nanos mRNA translation in Drosophila embryos by preventing its deadenylation by Smaug/CCR4. Development (2006) 133(22) 4573-83 [PubMed ID = 17050620] [RRC reference] |
| Stock Request | |
| Library & Clone Information |
|---|
| Library Name / Clone Name | GSV6 |
| Insertion Point | 20047102 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
| Flanking Sequence | AAATCGTGGGTATCAGGAACCTGTGTAGGATTACCTGGCTCAGTTCACTATTCCTAGGAA GTCACCTCAATCGGAAATTCTGGCTCAAATTTACTCGCCGTCTCTCCTCGTTTCGCGCGC TCTTTTCGCTCTCCGCCTGCACTTACTCGAGGATTTTGAAAGAAAAAGGAAGCCGCAGCT GGGGATTCAGCAATATTCGATATTCACTGTGAAATTTAACCGACTTCTACCGTTTTTGGT GCCTTTATTTGGGTC |
| Sequence Comment | 3R:20046803..20047102dmel-3R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data. |
| Library Name / Clone Name | GSV6 |
| Insertion Point | 20047102 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421) |
| Flanking Sequence | GTCGGAACAGAAGCGACGATTCTGCTAATCAACCTATTCGTTTTGGATCGCTCTTTCTTC TGCTGGGCCTCTGCTTTTCATTTATTTATCACGCGACTCGCTTTCATCGTCGGTTCTTGT TTTTGTATACATGGTGAGCAGTCGGAGTTGCCACTCGGTTTTATCAGCGGACGGTATCAC GGCAAGATTTGTCCAAAATGCGTGCTTATTCGTCCAACTGAAGTCCGGCCTAGTGTTCTG ATAAAGTGTGAGACAACGTTTGTTTGTAAAAAGAACTACTCAAATGGGATTTCAGTCAAA |
| Sequence Comment | 3R:20047102..20047401dmel-3R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data. |