Detailed Information [205055]
 

Strain Information
DGRC Number 205055
Genotype with FlyBase Link y[1] w[67c23]; P{w[+mC]=GSV1}LBR[GS2162] / SM1
Genotype y1 w67c23; P{w+mC=GSV1}LBRGS2162 / SM1
Break points/Insertion Site 057F10
Map Viewer
Received Date 12 December 2006
Original Number 2162
Chromosome 2R
Comments Received from Tokyo Metropolitan University.
Original Source Toshiro Aigaki. Tokyo Metropolitan University.
Original Comments Nucleotide map: 17228069
Vector: GSV1
General Information GS_lines
Genus Drosophila
Subgenus Sophophora
Species Group melanogaster
Species Subgroup melanogaster
Species melanogaster
Reference Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [RRC reference]
Last update 2020-04-03
Research papers using this strain
[Please submit your publication]
Lin ST, Zhang L, Lin X, Zhang LC, Garcia VE, Tsai CW, Pta?ek L, Fu YH.
Nuclear envelope protein MAN1 regulates clock through BMAL1.
Elife (2014) 3 e02981 [PubMed ID = 25182847] [RRC reference]

Toba G, Ohsako T, Miyata N, Ohtsuka T, Seong KH, Aigaki T.
The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster.
Genetics (1999) 151(2) 725-37 [PubMed ID = 9927464] [RRC reference]
Stock Request

Library & Clone Information
Library Name / Clone Name GSV1
Insertion Point 17228069 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 057F10
Flanking Sequence
TTGGTCTTTATAACCTACATATGTAAATAAAATGAGTACTGTTAGTCTTTGCAAAGATCA
AATACTCCAAAAAGTTTTCTATCGATTTATAATACTTGCGCATTGGTATGGTTCGATTAA
TGTTTAAGGGAATGTAAAAATAAGTACAAGTACTTTTAATACTTTAAAATAATTAACCTT
GAATACATTTTAAATTGTCTTAAAGTGCCCACTAAACCACTGTTAACGACACGCTGCGTG
CTGTTAGGCGCCGTT
Sequence Comment 2R:17227770..17228069dmel-2R-chromosome-r4.1.1.fasta. 5' upstream sequence from genome annotation release 4.1.1. This is not raw data.

Library Name / Clone Name GSV1
Insertion Point 17228069 (based on Drosophila melanogaster genome annotation release 4.1.1 date 20050421)
Chromosome Band 057F10
Flanking Sequence
TCATTTTACAACAAAATTTTCTCATCCGCCGACAACTAGACGCGCGTCTTTTTTATCAAG
TGATTTATGCTGAATTTACGGCGTTTCAATAGCCCCATAAAGTGAAAAACTACAAATAAA
TCCCATCAGAAGTGAGTTACTAAGTTGTGAAGCGTTAAAAGCTGTTTAAGCTAAGTTAAA
CATCGTTTAAAAACTGCCAGCCAAGAGGAAGAGAGCAAGAGAGAGAGCGCGTTCTGCCAG
CGTCGCTGCCTGCGGAATGTACAGTTGCGGCAGCGACGTCGCTTTTCCTTTCGGCGCGCA
Sequence Comment 2R:17228069..17228368dmel-2R-chromosome-r4.1.1.fasta. 3' downstream sequence from genome annotation release 4.1.1. This is not raw data.

CLOSE